Review



slc31a1  (Cell Signaling Technology Inc)


Bioz Verified Symbol Cell Signaling Technology Inc is a verified supplier
Bioz Manufacturer Symbol Cell Signaling Technology Inc manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Cell Signaling Technology Inc slc31a1
    Copper deprivation induced by SLC31A11 knockdown triggers the upregulation of SLC7A11. ( A ) Confocal imaging of Cu-probe and Mito-tracker in the NC and <t>SLC31A1</t> knockdown AsPC-1 cells. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( B ) Total Fe level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( C ) Volcano plot of gene expression (the SLC31A1 knockdown [shRNA#2] versus the control; log2(fold change) ≥1; p < 0.05 between SLC31A1 knockdown and NC AsPC-1 cells. ( D ) GO analysis of differentially expressed genes between SLC31A1 knockdown (shRNA#2) and NC AsPC-1 cells. ( E-G ) Western blot analysis of the indicated protein levels in the NC and SLC31A1 knockdown AsPC-1 (E), MiaPaCa-2 (F), and CFPAC-1 (G) cells. ( H and I ) GPX4 (H) or FSP-1 activity (I) was tested in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( J ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( K ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) GSH level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) Cystine uptake level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.
    Slc31a1, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 27 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/slc31a1/CTR1%2FSLC31A1+Antibody/pmc13019507-1-0-2
    Average 94 stars, based on 27 article reviews
    slc31a1 - by Bioz Stars, 2026-09
    94/100 stars

    Images

    1) Product Images from "Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11"

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    Journal: Redox Biology

    doi: 10.1016/j.redox.2026.104130

    Copper deprivation induced by SLC31A11 knockdown triggers the upregulation of SLC7A11. ( A ) Confocal imaging of Cu-probe and Mito-tracker in the NC and SLC31A1 knockdown AsPC-1 cells. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( B ) Total Fe level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( C ) Volcano plot of gene expression (the SLC31A1 knockdown [shRNA#2] versus the control; log2(fold change) ≥1; p < 0.05 between SLC31A1 knockdown and NC AsPC-1 cells. ( D ) GO analysis of differentially expressed genes between SLC31A1 knockdown (shRNA#2) and NC AsPC-1 cells. ( E-G ) Western blot analysis of the indicated protein levels in the NC and SLC31A1 knockdown AsPC-1 (E), MiaPaCa-2 (F), and CFPAC-1 (G) cells. ( H and I ) GPX4 (H) or FSP-1 activity (I) was tested in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( J ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( K ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) GSH level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) Cystine uptake level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.
    Figure Legend Snippet: Copper deprivation induced by SLC31A11 knockdown triggers the upregulation of SLC7A11. ( A ) Confocal imaging of Cu-probe and Mito-tracker in the NC and SLC31A1 knockdown AsPC-1 cells. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( B ) Total Fe level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( C ) Volcano plot of gene expression (the SLC31A1 knockdown [shRNA#2] versus the control; log2(fold change) ≥1; p < 0.05 between SLC31A1 knockdown and NC AsPC-1 cells. ( D ) GO analysis of differentially expressed genes between SLC31A1 knockdown (shRNA#2) and NC AsPC-1 cells. ( E-G ) Western blot analysis of the indicated protein levels in the NC and SLC31A1 knockdown AsPC-1 (E), MiaPaCa-2 (F), and CFPAC-1 (G) cells. ( H and I ) GPX4 (H) or FSP-1 activity (I) was tested in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( J ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( K ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) GSH level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) Cystine uptake level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.

    Techniques Used: Knockdown, Imaging, Gene Expression, shRNA, Control, Western Blot, Activity Assay

    Copper deprivation induced by SLC31A1 knockdown attenuates ferroptosis. ( A ) Cell viability of AsPC-1 cells treated with different doses of RSL3, ML162, ML210, or erastin in NC and SLC31A1 knockdown AsPC-1 cells. ( B ) Cell viability of AsPC-1 cells treated with different doses of CDDP, staurosporine, paclitaxel, bortezomib, JTC-801, or elesclomol-Cu in NC and SLC31A1 knockdown AsPC-1 cells. ( C-E ) Propidium iodide (PI) staining of NC and SLC31A1 knockdown AsPC-1 (C), MiaPaCa-2 (D), and CFPAC-1 (E) cells treated with RSL3 at the indicated concentrations in the presence or absence of ferroptosis inhibitors (ferrostatin-1/Fer-1, 5 μM or desferrioxamine/DFO, 20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( F ) Lipid peroxidation of NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. (G) Transmission electron microscopy of NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 (2.5 μM). Scale bar: 2 μm or 500 nm. ( H ) Confocal imaging of Cu-probe and Mito-tracker in the NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( I ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1. ( J ) Cell viability of NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1, followed by treatment with different doses of RSL3 or erastin. ( K ) PI staining of NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1, followed by treatment with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( L ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or SLC31A1 WT or SLC31A1 M154A plasmid. ( M ) PI staining of SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or SLC31A1 WT or SLC31A1 M154A plasmid, followed by treatment with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test.
    Figure Legend Snippet: Copper deprivation induced by SLC31A1 knockdown attenuates ferroptosis. ( A ) Cell viability of AsPC-1 cells treated with different doses of RSL3, ML162, ML210, or erastin in NC and SLC31A1 knockdown AsPC-1 cells. ( B ) Cell viability of AsPC-1 cells treated with different doses of CDDP, staurosporine, paclitaxel, bortezomib, JTC-801, or elesclomol-Cu in NC and SLC31A1 knockdown AsPC-1 cells. ( C-E ) Propidium iodide (PI) staining of NC and SLC31A1 knockdown AsPC-1 (C), MiaPaCa-2 (D), and CFPAC-1 (E) cells treated with RSL3 at the indicated concentrations in the presence or absence of ferroptosis inhibitors (ferrostatin-1/Fer-1, 5 μM or desferrioxamine/DFO, 20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( F ) Lipid peroxidation of NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. (G) Transmission electron microscopy of NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 (2.5 μM). Scale bar: 2 μm or 500 nm. ( H ) Confocal imaging of Cu-probe and Mito-tracker in the NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( I ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1. ( J ) Cell viability of NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1, followed by treatment with different doses of RSL3 or erastin. ( K ) PI staining of NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1, followed by treatment with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( L ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or SLC31A1 WT or SLC31A1 M154A plasmid. ( M ) PI staining of SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or SLC31A1 WT or SLC31A1 M154A plasmid, followed by treatment with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test.

    Techniques Used: Knockdown, Staining, Transmission Assay, Electron Microscopy, Imaging, shRNA, Transfection, Plasmid Preparation, Western Blot

    SLC7A11 is essential for copper deprivation-mediated ferroptosis resistance. ( A ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC), SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells. ( B ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells treated with or without TM (50 μM) for 24 h. ( C ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Propidium iodide (PI) staining of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( D ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). PI staining of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( E ) NC and SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Lipid peroxidation of the AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. ( F ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of TM (50 μM) for 2 h. ( G ) PI staining of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of BSO (500 μM) with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( H ) PI staining images of the indicated AsPC-1 cells treated with or without BSO (500 μM) plus TM sulfate (50 μM) with RSL3 at the indicated concentrations with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test.
    Figure Legend Snippet: SLC7A11 is essential for copper deprivation-mediated ferroptosis resistance. ( A ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC), SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells. ( B ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells treated with or without TM (50 μM) for 24 h. ( C ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Propidium iodide (PI) staining of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( D ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). PI staining of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( E ) NC and SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Lipid peroxidation of the AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. ( F ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of TM (50 μM) for 2 h. ( G ) PI staining of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of BSO (500 μM) with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( H ) PI staining images of the indicated AsPC-1 cells treated with or without BSO (500 μM) plus TM sulfate (50 μM) with RSL3 at the indicated concentrations with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test.

    Techniques Used: Knockdown, shRNA, Transfection, Western Blot, Staining

    SLC7A11 is essential for copper deprivation-mediated ferroptosis resistance. ( A ) Vector or flag-SLC7A11 overexpressed AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells. ( B ) AsPC-1 cells were transfected with a vector or a plasmid encoding Flag-SLC7A11 and then treated with TM (50 μM) for 24h. Western blot analysis of lysates from the indicated AsPC-1 cells. ( C ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11) with or without transfection with a blank vector or a vector encoding SLC7A11. PI staining of indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of Fer-1 (2.5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( D ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11) with or without transfection with a blank vector or a vector encoding SLC7A11. PI staining images of indicated AsPC-1 cells treated with RSL3 (0.25 μM) or TM (50 μM) in the presence or absence of Fer-1 (2.5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.
    Figure Legend Snippet: SLC7A11 is essential for copper deprivation-mediated ferroptosis resistance. ( A ) Vector or flag-SLC7A11 overexpressed AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells. ( B ) AsPC-1 cells were transfected with a vector or a plasmid encoding Flag-SLC7A11 and then treated with TM (50 μM) for 24h. Western blot analysis of lysates from the indicated AsPC-1 cells. ( C ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11) with or without transfection with a blank vector or a vector encoding SLC7A11. PI staining of indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of Fer-1 (2.5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( D ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11) with or without transfection with a blank vector or a vector encoding SLC7A11. PI staining images of indicated AsPC-1 cells treated with RSL3 (0.25 μM) or TM (50 μM) in the presence or absence of Fer-1 (2.5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

    Techniques Used: Plasmid Preparation, Transfection, Western Blot, Knockdown, shRNA, Staining

    Copper deprivation upregulates SLC7A11 and activates AMPK-NRF2 axis. ( A ) Volcano plot of NRF2 target genes (shSLC31A1 VS shNC) generated using the data from C. ( B , C ) ChIP analyses of NRF2 binding in the SLC7A11 promoter in NRF2 knockdown AsPC-1 cells (B) or SLC31A1 knockdown AsPC-1 cells (C). ( D-G ) The oxygen consumption rate (OCR) in NC and SLC31A1 knockdown AsPC-1 cells by Seahorse assay (n = 8/group). Quantification of basal respiration (E) and ATP-linked respiration (F), the uncoupler FCCP (maximal) or the electron transport inhibitor antimycin A-baseline (G) in NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 8. Statistical significance was determined using a one-way ANOVA test. ( H ) COX activity level in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( I–K ) ATP level in the NC and SLC31A1 knockdown AsPC-1(I), MiaPaCa-2 (J), and CFPAC-1 (K) cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) ATP level in the AsPC-1 cells treated with TM (50 μM) or TEPA (1 mM) for 24 h. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) AMP/ATP ratio detected by HPLC in NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using an unpaired T test. ( N ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells. ( O ) Western blot analysis of lysates from AsPC-1 cells treated with TM at the indicated concentrations for 24 h. ( P ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with blank vector or vector encoding SLC31A1. ( Q ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with blank vector or of SLC31A1 WT- or SLC31A1 M154A.
    Figure Legend Snippet: Copper deprivation upregulates SLC7A11 and activates AMPK-NRF2 axis. ( A ) Volcano plot of NRF2 target genes (shSLC31A1 VS shNC) generated using the data from C. ( B , C ) ChIP analyses of NRF2 binding in the SLC7A11 promoter in NRF2 knockdown AsPC-1 cells (B) or SLC31A1 knockdown AsPC-1 cells (C). ( D-G ) The oxygen consumption rate (OCR) in NC and SLC31A1 knockdown AsPC-1 cells by Seahorse assay (n = 8/group). Quantification of basal respiration (E) and ATP-linked respiration (F), the uncoupler FCCP (maximal) or the electron transport inhibitor antimycin A-baseline (G) in NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 8. Statistical significance was determined using a one-way ANOVA test. ( H ) COX activity level in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( I–K ) ATP level in the NC and SLC31A1 knockdown AsPC-1(I), MiaPaCa-2 (J), and CFPAC-1 (K) cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) ATP level in the AsPC-1 cells treated with TM (50 μM) or TEPA (1 mM) for 24 h. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) AMP/ATP ratio detected by HPLC in NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using an unpaired T test. ( N ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells. ( O ) Western blot analysis of lysates from AsPC-1 cells treated with TM at the indicated concentrations for 24 h. ( P ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with blank vector or vector encoding SLC31A1. ( Q ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with blank vector or of SLC31A1 WT- or SLC31A1 M154A.

    Techniques Used: Generated, Binding Assay, Knockdown, Activity Assay, Western Blot, shRNA, Transfection, Plasmid Preparation

    Copper deprivation upregulates SLC7A11 through AMPK-NRF2 axis. ( A ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). ( B ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNFE2L2#2). * indicates a non-specific band. ( C ) SLC7A11 mRNA level in NC and SLC31A1 knockdown AsPC-1 cells transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2#2). ( D ) Western blot analysis of lysates from AsPC-1 cells that were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2) and treated with TM (50 μM) or without TM for 24 h. ( E ) SLC7A11 mRNA level in AsPC-1 cells that were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2) and treated with TM (50 μM) or without TM for 24 h. ( F ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells treated with or without ML385 (5 μM) for 24 h. ( G ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid. ( H ) SLC7A11 mRNA level in SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.
    Figure Legend Snippet: Copper deprivation upregulates SLC7A11 through AMPK-NRF2 axis. ( A ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). ( B ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNFE2L2#2). * indicates a non-specific band. ( C ) SLC7A11 mRNA level in NC and SLC31A1 knockdown AsPC-1 cells transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2#2). ( D ) Western blot analysis of lysates from AsPC-1 cells that were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2) and treated with TM (50 μM) or without TM for 24 h. ( E ) SLC7A11 mRNA level in AsPC-1 cells that were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2) and treated with TM (50 μM) or without TM for 24 h. ( F ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells treated with or without ML385 (5 μM) for 24 h. ( G ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid. ( H ) SLC7A11 mRNA level in SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.

    Techniques Used: Western Blot, Knockdown, shRNA, Transfection, Plasmid Preparation

    Copper deprivation inhibits ferroptosis by the activation of AMPK. ( A ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). Propidium iodide (PI) staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( B ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( C ) PI staining of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of Compound C (10 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.
    Figure Legend Snippet: Copper deprivation inhibits ferroptosis by the activation of AMPK. ( A ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). Propidium iodide (PI) staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( B ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( C ) PI staining of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of Compound C (10 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

    Techniques Used: Activation Assay, Knockdown, shRNA, Transfection, Staining

    Copper deprivation inhibits ferroptosis by the activation of AMPK-NRF2-SLC7A11 pathway. ( A ) NC and SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA#2 (shNRF2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( B ) AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( C ) SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA#2 (shNRF2). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. ( D ) AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of TM (50 μM) for 2 h. ( E ) PI staining images of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of ML385 (5 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( F ) PI staining of SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid, followed by treatment with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.
    Figure Legend Snippet: Copper deprivation inhibits ferroptosis by the activation of AMPK-NRF2-SLC7A11 pathway. ( A ) NC and SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA#2 (shNRF2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( B ) AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( C ) SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA#2 (shNRF2). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. ( D ) AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of TM (50 μM) for 2 h. ( E ) PI staining images of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of ML385 (5 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( F ) PI staining of SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid, followed by treatment with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

    Techniques Used: Activation Assay, Knockdown, Transfection, shRNA, Staining, Plasmid Preparation

    SLC31A1 knockdown inhibits ferroptosis in vivo . ( A-D ) Subcutaneous growth of NC and SLC31A1 knockdown AsPC-1 xenografts in nude mice (n = 8) treated with RSL3 (5 mg/kg, i.p., once every other day). ( A ) Tumor growth curves of NC and SLC31A1 knockdown AsPC-1 xenografts in nude mice treated with the indicated agents. Representative images of tumors and tumor weight were shown ( B ). Data are presented as mean ± SD, n = 8 mice per group; Statistical significance was determined using a two-way ANOVA test. ( C ) Total copper content in the tumor sections. Statistical significance was determined using a two-way ANOVA test. ( D and E ) Immunohistochemical staining and relative staining intensity of the indicated proteins in the tumor sections. CC3, cleaved caspase 3. Scale bar: 20 μm. Statistical significance was determined using a two-way ANOVA test.
    Figure Legend Snippet: SLC31A1 knockdown inhibits ferroptosis in vivo . ( A-D ) Subcutaneous growth of NC and SLC31A1 knockdown AsPC-1 xenografts in nude mice (n = 8) treated with RSL3 (5 mg/kg, i.p., once every other day). ( A ) Tumor growth curves of NC and SLC31A1 knockdown AsPC-1 xenografts in nude mice treated with the indicated agents. Representative images of tumors and tumor weight were shown ( B ). Data are presented as mean ± SD, n = 8 mice per group; Statistical significance was determined using a two-way ANOVA test. ( C ) Total copper content in the tumor sections. Statistical significance was determined using a two-way ANOVA test. ( D and E ) Immunohistochemical staining and relative staining intensity of the indicated proteins in the tumor sections. CC3, cleaved caspase 3. Scale bar: 20 μm. Statistical significance was determined using a two-way ANOVA test.

    Techniques Used: Knockdown, In Vivo, Immunohistochemical staining, Staining

    Related Articles

    other:

    Article Title: Copper potentiates PUFA-mediated antitumor activity by activating Lipophagy.
    Article Snippet: Polyunsaturated fatty acids (PUFAs) have demonstrated promising anticancer properties by inducing cancer cell death and inhibiting cancer metastasis.. As dynamic organelles, lipid droplets (LDs) may protect cells from PUFAinduced lipotoxicity by sequestering excess fatty acids.. However, the underlying mechanisms regulating LDs dynamics in PUFA-mediated tumor cytotoxicity remain poorly understood.

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11
    Article Snippet: SLC31A1 , Cell Signaling Technology , 13086.

    Electrophoresis:

    Article Title: The effect of cuproptosis-related gene Atox1 on cardiac hypertrophy in heart failure was investigated based on bioinformatics analysis.
    Article Snippet: .. Subsequently, after electrophoresis, the proteins were electrotransferred to a membrane and incubated with the following primary antibodies: FDX1 (Abcam, ab108257) and SLC31A1 (cell signaling technology, 13086). .. GAPDH (Invitrogen, PA1-988) was the internal reference gene.

    Article Title: The effect of cuproptosis-related gene Atox1 on cardiac hypertrophy in heart failure was investigated based on bioinformatics analysis
    Article Snippet: .. Subsequently, after electrophoresis, the proteins were electrotransferred to a membrane and incubated with the following primary antibodies: FDX1 (Abcam, ab108257) and SLC31A1 (cell signaling technology, 13086). .. GAPDH (Invitrogen, PA1-988) was the internal reference gene.

    Membrane:

    Article Title: The effect of cuproptosis-related gene Atox1 on cardiac hypertrophy in heart failure was investigated based on bioinformatics analysis.
    Article Snippet: .. Subsequently, after electrophoresis, the proteins were electrotransferred to a membrane and incubated with the following primary antibodies: FDX1 (Abcam, ab108257) and SLC31A1 (cell signaling technology, 13086). .. GAPDH (Invitrogen, PA1-988) was the internal reference gene.

    Article Title: The effect of cuproptosis-related gene Atox1 on cardiac hypertrophy in heart failure was investigated based on bioinformatics analysis
    Article Snippet: .. Subsequently, after electrophoresis, the proteins were electrotransferred to a membrane and incubated with the following primary antibodies: FDX1 (Abcam, ab108257) and SLC31A1 (cell signaling technology, 13086). .. GAPDH (Invitrogen, PA1-988) was the internal reference gene.

    Incubation:

    Article Title: The effect of cuproptosis-related gene Atox1 on cardiac hypertrophy in heart failure was investigated based on bioinformatics analysis.
    Article Snippet: .. Subsequently, after electrophoresis, the proteins were electrotransferred to a membrane and incubated with the following primary antibodies: FDX1 (Abcam, ab108257) and SLC31A1 (cell signaling technology, 13086). .. GAPDH (Invitrogen, PA1-988) was the internal reference gene.

    Article Title: The effect of cuproptosis-related gene Atox1 on cardiac hypertrophy in heart failure was investigated based on bioinformatics analysis
    Article Snippet: .. Subsequently, after electrophoresis, the proteins were electrotransferred to a membrane and incubated with the following primary antibodies: FDX1 (Abcam, ab108257) and SLC31A1 (cell signaling technology, 13086). .. GAPDH (Invitrogen, PA1-988) was the internal reference gene.

    Article Title: ARNTL2 facilitates bladder cancer progression through potentiating ENO1-mediated glycolysis in a SLC31A1-independent and -dependent manner.
    Article Snippet: This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record.. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article.. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

    Article Title: The up-regulation of PTBP1 expression level in patients with Insomnia by senile dementia and promote cuproptosis of nerve cell by SLC31A1.
    Article Snippet: Alzheimer’s disease (AD), often referred to as the modern-day scourge, stands as a significant health challenge characterized by high rates of disability and mortality, particularly among the geriatric population.. Thus, the present study investigated the precise details of PTBP1 involvement in cuproptosis of nerve cell of patients with Insomnia by senile dementia (ISD).. Patients with ISD, early mild cognitive impairment (EMCI) and Normal healthy volunteers were obtained.



    Similar Products

    94
    Cell Signaling Technology Inc slc31a1
    Copper deprivation induced by SLC31A11 knockdown triggers the upregulation of SLC7A11. ( A ) Confocal imaging of Cu-probe and Mito-tracker in the NC and <t>SLC31A1</t> knockdown AsPC-1 cells. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( B ) Total Fe level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( C ) Volcano plot of gene expression (the SLC31A1 knockdown [shRNA#2] versus the control; log2(fold change) ≥1; p < 0.05 between SLC31A1 knockdown and NC AsPC-1 cells. ( D ) GO analysis of differentially expressed genes between SLC31A1 knockdown (shRNA#2) and NC AsPC-1 cells. ( E-G ) Western blot analysis of the indicated protein levels in the NC and SLC31A1 knockdown AsPC-1 (E), MiaPaCa-2 (F), and CFPAC-1 (G) cells. ( H and I ) GPX4 (H) or FSP-1 activity (I) was tested in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( J ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( K ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) GSH level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) Cystine uptake level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.
    Slc31a1, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/slc31a1/CTR1%2FSLC31A1+Antibody/pmc13019507-1-0-2
    Average 94 stars, based on 1 article reviews
    slc31a1 - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    86
    Shanghai Genechem Ltd slc31a1 m154a
    Copper deprivation induced by SLC31A11 knockdown triggers the upregulation of SLC7A11. ( A ) Confocal imaging of Cu-probe and Mito-tracker in the NC and <t>SLC31A1</t> knockdown AsPC-1 cells. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( B ) Total Fe level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( C ) Volcano plot of gene expression (the SLC31A1 knockdown [shRNA#2] versus the control; log2(fold change) ≥1; p < 0.05 between SLC31A1 knockdown and NC AsPC-1 cells. ( D ) GO analysis of differentially expressed genes between SLC31A1 knockdown (shRNA#2) and NC AsPC-1 cells. ( E-G ) Western blot analysis of the indicated protein levels in the NC and SLC31A1 knockdown AsPC-1 (E), MiaPaCa-2 (F), and CFPAC-1 (G) cells. ( H and I ) GPX4 (H) or FSP-1 activity (I) was tested in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( J ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( K ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) GSH level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) Cystine uptake level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.
    Slc31a1 M154a, supplied by Shanghai Genechem Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/slc31a1/m154a+slc31a1/pmc13019507-88-0-5
    Average 86 stars, based on 1 article reviews
    slc31a1 m154a - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Shanghai Genechem Ltd slc31a1 wt
    Copper deprivation induced by SLC31A11 knockdown triggers the upregulation of SLC7A11. ( A ) Confocal imaging of Cu-probe and Mito-tracker in the NC and <t>SLC31A1</t> knockdown AsPC-1 cells. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( B ) Total Fe level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( C ) Volcano plot of gene expression (the SLC31A1 knockdown [shRNA#2] versus the control; log2(fold change) ≥1; p < 0.05 between SLC31A1 knockdown and NC AsPC-1 cells. ( D ) GO analysis of differentially expressed genes between SLC31A1 knockdown (shRNA#2) and NC AsPC-1 cells. ( E-G ) Western blot analysis of the indicated protein levels in the NC and SLC31A1 knockdown AsPC-1 (E), MiaPaCa-2 (F), and CFPAC-1 (G) cells. ( H and I ) GPX4 (H) or FSP-1 activity (I) was tested in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( J ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( K ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) GSH level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) Cystine uptake level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.
    Slc31a1 Wt, supplied by Shanghai Genechem Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/slc31a1/m154a+slc31a1/pmc13019507-87-0-5
    Average 86 stars, based on 1 article reviews
    slc31a1 wt - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Sangon Biotech human slc31a1 rna primers f ccaggaccaaatggaaccatcc r accacctggatgatgtgcagca
    Copper deprivation induced by SLC31A11 knockdown triggers the upregulation of SLC7A11. ( A ) Confocal imaging of Cu-probe and Mito-tracker in the NC and <t>SLC31A1</t> knockdown AsPC-1 cells. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( B ) Total Fe level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( C ) Volcano plot of gene expression (the SLC31A1 knockdown [shRNA#2] versus the control; log2(fold change) ≥1; p < 0.05 between SLC31A1 knockdown and NC AsPC-1 cells. ( D ) GO analysis of differentially expressed genes between SLC31A1 knockdown (shRNA#2) and NC AsPC-1 cells. ( E-G ) Western blot analysis of the indicated protein levels in the NC and SLC31A1 knockdown AsPC-1 (E), MiaPaCa-2 (F), and CFPAC-1 (G) cells. ( H and I ) GPX4 (H) or FSP-1 activity (I) was tested in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( J ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( K ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) GSH level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) Cystine uptake level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.
    Human Slc31a1 Rna Primers F Ccaggaccaaatggaaccatcc R Accacctggatgatgtgcagca, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/slc31a1/apoa1+biotech+ccctgggatcgagtgaagga+f+gcaggtaatcccaaaagcgac+primer+r+sangon/pmc13019507-93-0-9
    Average 86 stars, based on 1 article reviews
    human slc31a1 rna primers f ccaggaccaaatggaaccatcc r accacctggatgatgtgcagca - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    94
    Proteintech slc31a1
    PKA mitigated copper overload triggered by SiNPs. (A) In the SiNPs-instilled rats, enhanced copper contents in both serum (a) and myocardial tissues (b) were detected, but PKA agonist Forskolin reversed it. n = 9-10 per group. (B) The dose-dependent elevation of intracellular Cu 2+ content by SiNPs treatment in the in vitro cultured AC16 cardiomyocytes (a), which could be greatly reduced by PKA stimulator 8-Br-cAMP but increased by PKA inhibitor H89 (b). (C) The expressions of copper metabolism-related protein (FDX1, <t>SLC31A1,</t> and ATP7B) in AC16 cells were measured (C-a, protein bands; C-b, bands analysis). Also, the expression of ATP7B was measured in rat myocardial tissue (D). n = 3. ∗ p < 0.05 vs control, # p < 0.05 vs SiNPs or SiNPs + Forskolin.
    Slc31a1, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/slc31a1/SLC31A1+Antibody/pmc13014970-43-10-20
    Average 94 stars, based on 1 article reviews
    slc31a1 - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    Proteintech anti slc31a1 abways
    PKA mitigated copper overload triggered by SiNPs. (A) In the SiNPs-instilled rats, enhanced copper contents in both serum (a) and myocardial tissues (b) were detected, but PKA agonist Forskolin reversed it. n = 9-10 per group. (B) The dose-dependent elevation of intracellular Cu 2+ content by SiNPs treatment in the in vitro cultured AC16 cardiomyocytes (a), which could be greatly reduced by PKA stimulator 8-Br-cAMP but increased by PKA inhibitor H89 (b). (C) The expressions of copper metabolism-related protein (FDX1, <t>SLC31A1,</t> and ATP7B) in AC16 cells were measured (C-a, protein bands; C-b, bands analysis). Also, the expression of ATP7B was measured in rat myocardial tissue (D). n = 3. ∗ p < 0.05 vs control, # p < 0.05 vs SiNPs or SiNPs + Forskolin.
    Anti Slc31a1 Abways, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/slc31a1/SLC31A1+Antibody/pm41912773-67-14-17
    Average 94 stars, based on 1 article reviews
    anti slc31a1 abways - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    Proteintech ctr1
    Transcriptomic analysis reveals tannic acid's anti-fibrotic mechanisms in injured rabbit corneas. ( A ) Volcano plot showing differentially expressed genes (DEGs) between TA-treated and control groups ( n = 3). ( B ) Gene Ontology (GO) enrichment analysis of DEGs, categorized into biological process (BP), cellular component (CC), and molecular function (MF). ( C ) Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis of DEGs. ( D ) Gene Set Enrichment Analysis (GSEA) based on REACTOME gene sets. ( E ) Heatmap displaying key DEGs associated with inflammatory response, redox homeostasis, and corneal scarring. ( F – K ) RT-qPCR validation of mRNA expression levels of representative genes in rabbit corneas at day 28 following different treatments ( n = 3), including F SOD2 , G ACTA2 , H IL1B , I LOX , J LOXL2 , and K <t>SLC31A1</t> . * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001. Mean ± SD, 1-way ANOVA.
    Ctr1, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/slc31a1/SLC31A1+Antibody/pmc12974537-92-17-20
    Average 94 stars, based on 1 article reviews
    ctr1 - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    Image Search Results


    Copper deprivation induced by SLC31A11 knockdown triggers the upregulation of SLC7A11. ( A ) Confocal imaging of Cu-probe and Mito-tracker in the NC and SLC31A1 knockdown AsPC-1 cells. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( B ) Total Fe level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( C ) Volcano plot of gene expression (the SLC31A1 knockdown [shRNA#2] versus the control; log2(fold change) ≥1; p < 0.05 between SLC31A1 knockdown and NC AsPC-1 cells. ( D ) GO analysis of differentially expressed genes between SLC31A1 knockdown (shRNA#2) and NC AsPC-1 cells. ( E-G ) Western blot analysis of the indicated protein levels in the NC and SLC31A1 knockdown AsPC-1 (E), MiaPaCa-2 (F), and CFPAC-1 (G) cells. ( H and I ) GPX4 (H) or FSP-1 activity (I) was tested in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( J ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( K ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) GSH level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) Cystine uptake level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: Copper deprivation induced by SLC31A11 knockdown triggers the upregulation of SLC7A11. ( A ) Confocal imaging of Cu-probe and Mito-tracker in the NC and SLC31A1 knockdown AsPC-1 cells. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( B ) Total Fe level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( C ) Volcano plot of gene expression (the SLC31A1 knockdown [shRNA#2] versus the control; log2(fold change) ≥1; p < 0.05 between SLC31A1 knockdown and NC AsPC-1 cells. ( D ) GO analysis of differentially expressed genes between SLC31A1 knockdown (shRNA#2) and NC AsPC-1 cells. ( E-G ) Western blot analysis of the indicated protein levels in the NC and SLC31A1 knockdown AsPC-1 (E), MiaPaCa-2 (F), and CFPAC-1 (G) cells. ( H and I ) GPX4 (H) or FSP-1 activity (I) was tested in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( J ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( K ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) GSH level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) Cystine uptake level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.

    Article Snippet: SLC31A1 , Cell Signaling Technology , 13086.

    Techniques: Knockdown, Imaging, Gene Expression, shRNA, Control, Western Blot, Activity Assay

    Copper deprivation induced by SLC31A1 knockdown attenuates ferroptosis. ( A ) Cell viability of AsPC-1 cells treated with different doses of RSL3, ML162, ML210, or erastin in NC and SLC31A1 knockdown AsPC-1 cells. ( B ) Cell viability of AsPC-1 cells treated with different doses of CDDP, staurosporine, paclitaxel, bortezomib, JTC-801, or elesclomol-Cu in NC and SLC31A1 knockdown AsPC-1 cells. ( C-E ) Propidium iodide (PI) staining of NC and SLC31A1 knockdown AsPC-1 (C), MiaPaCa-2 (D), and CFPAC-1 (E) cells treated with RSL3 at the indicated concentrations in the presence or absence of ferroptosis inhibitors (ferrostatin-1/Fer-1, 5 μM or desferrioxamine/DFO, 20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( F ) Lipid peroxidation of NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. (G) Transmission electron microscopy of NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 (2.5 μM). Scale bar: 2 μm or 500 nm. ( H ) Confocal imaging of Cu-probe and Mito-tracker in the NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( I ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1. ( J ) Cell viability of NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1, followed by treatment with different doses of RSL3 or erastin. ( K ) PI staining of NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1, followed by treatment with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( L ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or SLC31A1 WT or SLC31A1 M154A plasmid. ( M ) PI staining of SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or SLC31A1 WT or SLC31A1 M154A plasmid, followed by treatment with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: Copper deprivation induced by SLC31A1 knockdown attenuates ferroptosis. ( A ) Cell viability of AsPC-1 cells treated with different doses of RSL3, ML162, ML210, or erastin in NC and SLC31A1 knockdown AsPC-1 cells. ( B ) Cell viability of AsPC-1 cells treated with different doses of CDDP, staurosporine, paclitaxel, bortezomib, JTC-801, or elesclomol-Cu in NC and SLC31A1 knockdown AsPC-1 cells. ( C-E ) Propidium iodide (PI) staining of NC and SLC31A1 knockdown AsPC-1 (C), MiaPaCa-2 (D), and CFPAC-1 (E) cells treated with RSL3 at the indicated concentrations in the presence or absence of ferroptosis inhibitors (ferrostatin-1/Fer-1, 5 μM or desferrioxamine/DFO, 20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( F ) Lipid peroxidation of NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. (G) Transmission electron microscopy of NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 (2.5 μM). Scale bar: 2 μm or 500 nm. ( H ) Confocal imaging of Cu-probe and Mito-tracker in the NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( I ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1. ( J ) Cell viability of NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1, followed by treatment with different doses of RSL3 or erastin. ( K ) PI staining of NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1, followed by treatment with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( L ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or SLC31A1 WT or SLC31A1 M154A plasmid. ( M ) PI staining of SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or SLC31A1 WT or SLC31A1 M154A plasmid, followed by treatment with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test.

    Article Snippet: SLC31A1 , Cell Signaling Technology , 13086.

    Techniques: Knockdown, Staining, Transmission Assay, Electron Microscopy, Imaging, shRNA, Transfection, Plasmid Preparation, Western Blot

    SLC7A11 is essential for copper deprivation-mediated ferroptosis resistance. ( A ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC), SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells. ( B ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells treated with or without TM (50 μM) for 24 h. ( C ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Propidium iodide (PI) staining of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( D ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). PI staining of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( E ) NC and SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Lipid peroxidation of the AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. ( F ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of TM (50 μM) for 2 h. ( G ) PI staining of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of BSO (500 μM) with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( H ) PI staining images of the indicated AsPC-1 cells treated with or without BSO (500 μM) plus TM sulfate (50 μM) with RSL3 at the indicated concentrations with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: SLC7A11 is essential for copper deprivation-mediated ferroptosis resistance. ( A ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC), SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells. ( B ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells treated with or without TM (50 μM) for 24 h. ( C ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Propidium iodide (PI) staining of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( D ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). PI staining of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( E ) NC and SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Lipid peroxidation of the AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. ( F ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of TM (50 μM) for 2 h. ( G ) PI staining of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of BSO (500 μM) with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( H ) PI staining images of the indicated AsPC-1 cells treated with or without BSO (500 μM) plus TM sulfate (50 μM) with RSL3 at the indicated concentrations with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test.

    Article Snippet: SLC31A1 , Cell Signaling Technology , 13086.

    Techniques: Knockdown, shRNA, Transfection, Western Blot, Staining

    SLC7A11 is essential for copper deprivation-mediated ferroptosis resistance. ( A ) Vector or flag-SLC7A11 overexpressed AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells. ( B ) AsPC-1 cells were transfected with a vector or a plasmid encoding Flag-SLC7A11 and then treated with TM (50 μM) for 24h. Western blot analysis of lysates from the indicated AsPC-1 cells. ( C ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11) with or without transfection with a blank vector or a vector encoding SLC7A11. PI staining of indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of Fer-1 (2.5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( D ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11) with or without transfection with a blank vector or a vector encoding SLC7A11. PI staining images of indicated AsPC-1 cells treated with RSL3 (0.25 μM) or TM (50 μM) in the presence or absence of Fer-1 (2.5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: SLC7A11 is essential for copper deprivation-mediated ferroptosis resistance. ( A ) Vector or flag-SLC7A11 overexpressed AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells. ( B ) AsPC-1 cells were transfected with a vector or a plasmid encoding Flag-SLC7A11 and then treated with TM (50 μM) for 24h. Western blot analysis of lysates from the indicated AsPC-1 cells. ( C ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11) with or without transfection with a blank vector or a vector encoding SLC7A11. PI staining of indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of Fer-1 (2.5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( D ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11) with or without transfection with a blank vector or a vector encoding SLC7A11. PI staining images of indicated AsPC-1 cells treated with RSL3 (0.25 μM) or TM (50 μM) in the presence or absence of Fer-1 (2.5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

    Article Snippet: SLC31A1 , Cell Signaling Technology , 13086.

    Techniques: Plasmid Preparation, Transfection, Western Blot, Knockdown, shRNA, Staining

    Copper deprivation upregulates SLC7A11 and activates AMPK-NRF2 axis. ( A ) Volcano plot of NRF2 target genes (shSLC31A1 VS shNC) generated using the data from C. ( B , C ) ChIP analyses of NRF2 binding in the SLC7A11 promoter in NRF2 knockdown AsPC-1 cells (B) or SLC31A1 knockdown AsPC-1 cells (C). ( D-G ) The oxygen consumption rate (OCR) in NC and SLC31A1 knockdown AsPC-1 cells by Seahorse assay (n = 8/group). Quantification of basal respiration (E) and ATP-linked respiration (F), the uncoupler FCCP (maximal) or the electron transport inhibitor antimycin A-baseline (G) in NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 8. Statistical significance was determined using a one-way ANOVA test. ( H ) COX activity level in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( I–K ) ATP level in the NC and SLC31A1 knockdown AsPC-1(I), MiaPaCa-2 (J), and CFPAC-1 (K) cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) ATP level in the AsPC-1 cells treated with TM (50 μM) or TEPA (1 mM) for 24 h. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) AMP/ATP ratio detected by HPLC in NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using an unpaired T test. ( N ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells. ( O ) Western blot analysis of lysates from AsPC-1 cells treated with TM at the indicated concentrations for 24 h. ( P ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with blank vector or vector encoding SLC31A1. ( Q ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with blank vector or of SLC31A1 WT- or SLC31A1 M154A.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: Copper deprivation upregulates SLC7A11 and activates AMPK-NRF2 axis. ( A ) Volcano plot of NRF2 target genes (shSLC31A1 VS shNC) generated using the data from C. ( B , C ) ChIP analyses of NRF2 binding in the SLC7A11 promoter in NRF2 knockdown AsPC-1 cells (B) or SLC31A1 knockdown AsPC-1 cells (C). ( D-G ) The oxygen consumption rate (OCR) in NC and SLC31A1 knockdown AsPC-1 cells by Seahorse assay (n = 8/group). Quantification of basal respiration (E) and ATP-linked respiration (F), the uncoupler FCCP (maximal) or the electron transport inhibitor antimycin A-baseline (G) in NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 8. Statistical significance was determined using a one-way ANOVA test. ( H ) COX activity level in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( I–K ) ATP level in the NC and SLC31A1 knockdown AsPC-1(I), MiaPaCa-2 (J), and CFPAC-1 (K) cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) ATP level in the AsPC-1 cells treated with TM (50 μM) or TEPA (1 mM) for 24 h. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) AMP/ATP ratio detected by HPLC in NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using an unpaired T test. ( N ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells. ( O ) Western blot analysis of lysates from AsPC-1 cells treated with TM at the indicated concentrations for 24 h. ( P ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with blank vector or vector encoding SLC31A1. ( Q ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with blank vector or of SLC31A1 WT- or SLC31A1 M154A.

    Article Snippet: SLC31A1 , Cell Signaling Technology , 13086.

    Techniques: Generated, Binding Assay, Knockdown, Activity Assay, Western Blot, shRNA, Transfection, Plasmid Preparation

    Copper deprivation upregulates SLC7A11 through AMPK-NRF2 axis. ( A ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). ( B ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNFE2L2#2). * indicates a non-specific band. ( C ) SLC7A11 mRNA level in NC and SLC31A1 knockdown AsPC-1 cells transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2#2). ( D ) Western blot analysis of lysates from AsPC-1 cells that were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2) and treated with TM (50 μM) or without TM for 24 h. ( E ) SLC7A11 mRNA level in AsPC-1 cells that were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2) and treated with TM (50 μM) or without TM for 24 h. ( F ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells treated with or without ML385 (5 μM) for 24 h. ( G ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid. ( H ) SLC7A11 mRNA level in SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: Copper deprivation upregulates SLC7A11 through AMPK-NRF2 axis. ( A ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). ( B ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNFE2L2#2). * indicates a non-specific band. ( C ) SLC7A11 mRNA level in NC and SLC31A1 knockdown AsPC-1 cells transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2#2). ( D ) Western blot analysis of lysates from AsPC-1 cells that were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2) and treated with TM (50 μM) or without TM for 24 h. ( E ) SLC7A11 mRNA level in AsPC-1 cells that were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2) and treated with TM (50 μM) or without TM for 24 h. ( F ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells treated with or without ML385 (5 μM) for 24 h. ( G ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid. ( H ) SLC7A11 mRNA level in SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.

    Article Snippet: SLC31A1 , Cell Signaling Technology , 13086.

    Techniques: Western Blot, Knockdown, shRNA, Transfection, Plasmid Preparation

    Copper deprivation inhibits ferroptosis by the activation of AMPK. ( A ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). Propidium iodide (PI) staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( B ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( C ) PI staining of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of Compound C (10 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: Copper deprivation inhibits ferroptosis by the activation of AMPK. ( A ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). Propidium iodide (PI) staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( B ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( C ) PI staining of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of Compound C (10 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

    Article Snippet: SLC31A1 , Cell Signaling Technology , 13086.

    Techniques: Activation Assay, Knockdown, shRNA, Transfection, Staining

    Copper deprivation inhibits ferroptosis by the activation of AMPK-NRF2-SLC7A11 pathway. ( A ) NC and SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA#2 (shNRF2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( B ) AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( C ) SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA#2 (shNRF2). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. ( D ) AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of TM (50 μM) for 2 h. ( E ) PI staining images of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of ML385 (5 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( F ) PI staining of SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid, followed by treatment with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: Copper deprivation inhibits ferroptosis by the activation of AMPK-NRF2-SLC7A11 pathway. ( A ) NC and SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA#2 (shNRF2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( B ) AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( C ) SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA#2 (shNRF2). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. ( D ) AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of TM (50 μM) for 2 h. ( E ) PI staining images of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of ML385 (5 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( F ) PI staining of SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid, followed by treatment with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

    Article Snippet: SLC31A1 , Cell Signaling Technology , 13086.

    Techniques: Activation Assay, Knockdown, Transfection, shRNA, Staining, Plasmid Preparation

    SLC31A1 knockdown inhibits ferroptosis in vivo . ( A-D ) Subcutaneous growth of NC and SLC31A1 knockdown AsPC-1 xenografts in nude mice (n = 8) treated with RSL3 (5 mg/kg, i.p., once every other day). ( A ) Tumor growth curves of NC and SLC31A1 knockdown AsPC-1 xenografts in nude mice treated with the indicated agents. Representative images of tumors and tumor weight were shown ( B ). Data are presented as mean ± SD, n = 8 mice per group; Statistical significance was determined using a two-way ANOVA test. ( C ) Total copper content in the tumor sections. Statistical significance was determined using a two-way ANOVA test. ( D and E ) Immunohistochemical staining and relative staining intensity of the indicated proteins in the tumor sections. CC3, cleaved caspase 3. Scale bar: 20 μm. Statistical significance was determined using a two-way ANOVA test.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: SLC31A1 knockdown inhibits ferroptosis in vivo . ( A-D ) Subcutaneous growth of NC and SLC31A1 knockdown AsPC-1 xenografts in nude mice (n = 8) treated with RSL3 (5 mg/kg, i.p., once every other day). ( A ) Tumor growth curves of NC and SLC31A1 knockdown AsPC-1 xenografts in nude mice treated with the indicated agents. Representative images of tumors and tumor weight were shown ( B ). Data are presented as mean ± SD, n = 8 mice per group; Statistical significance was determined using a two-way ANOVA test. ( C ) Total copper content in the tumor sections. Statistical significance was determined using a two-way ANOVA test. ( D and E ) Immunohistochemical staining and relative staining intensity of the indicated proteins in the tumor sections. CC3, cleaved caspase 3. Scale bar: 20 μm. Statistical significance was determined using a two-way ANOVA test.

    Article Snippet: SLC31A1 , Cell Signaling Technology , 13086.

    Techniques: Knockdown, In Vivo, Immunohistochemical staining, Staining

    Copper deprivation induced by SLC31A11 knockdown triggers the upregulation of SLC7A11. ( A ) Confocal imaging of Cu-probe and Mito-tracker in the NC and SLC31A1 knockdown AsPC-1 cells. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( B ) Total Fe level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( C ) Volcano plot of gene expression (the SLC31A1 knockdown [shRNA#2] versus the control; log2(fold change) ≥1; p < 0.05 between SLC31A1 knockdown and NC AsPC-1 cells. ( D ) GO analysis of differentially expressed genes between SLC31A1 knockdown (shRNA#2) and NC AsPC-1 cells. ( E-G ) Western blot analysis of the indicated protein levels in the NC and SLC31A1 knockdown AsPC-1 (E), MiaPaCa-2 (F), and CFPAC-1 (G) cells. ( H and I ) GPX4 (H) or FSP-1 activity (I) was tested in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( J ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( K ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) GSH level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) Cystine uptake level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: Copper deprivation induced by SLC31A11 knockdown triggers the upregulation of SLC7A11. ( A ) Confocal imaging of Cu-probe and Mito-tracker in the NC and SLC31A1 knockdown AsPC-1 cells. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( B ) Total Fe level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( C ) Volcano plot of gene expression (the SLC31A1 knockdown [shRNA#2] versus the control; log2(fold change) ≥1; p < 0.05 between SLC31A1 knockdown and NC AsPC-1 cells. ( D ) GO analysis of differentially expressed genes between SLC31A1 knockdown (shRNA#2) and NC AsPC-1 cells. ( E-G ) Western blot analysis of the indicated protein levels in the NC and SLC31A1 knockdown AsPC-1 (E), MiaPaCa-2 (F), and CFPAC-1 (G) cells. ( H and I ) GPX4 (H) or FSP-1 activity (I) was tested in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( J ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( K ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) GSH level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) Cystine uptake level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.

    Article Snippet: SLC31A1 M154A (with Flag) , Shanghai Genechem , This paper.

    Techniques: Knockdown, Imaging, Gene Expression, shRNA, Control, Western Blot, Activity Assay

    Copper deprivation induced by SLC31A1 knockdown attenuates ferroptosis. ( A ) Cell viability of AsPC-1 cells treated with different doses of RSL3, ML162, ML210, or erastin in NC and SLC31A1 knockdown AsPC-1 cells. ( B ) Cell viability of AsPC-1 cells treated with different doses of CDDP, staurosporine, paclitaxel, bortezomib, JTC-801, or elesclomol-Cu in NC and SLC31A1 knockdown AsPC-1 cells. ( C-E ) Propidium iodide (PI) staining of NC and SLC31A1 knockdown AsPC-1 (C), MiaPaCa-2 (D), and CFPAC-1 (E) cells treated with RSL3 at the indicated concentrations in the presence or absence of ferroptosis inhibitors (ferrostatin-1/Fer-1, 5 μM or desferrioxamine/DFO, 20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( F ) Lipid peroxidation of NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. (G) Transmission electron microscopy of NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 (2.5 μM). Scale bar: 2 μm or 500 nm. ( H ) Confocal imaging of Cu-probe and Mito-tracker in the NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( I ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1. ( J ) Cell viability of NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1, followed by treatment with different doses of RSL3 or erastin. ( K ) PI staining of NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1, followed by treatment with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( L ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or SLC31A1 WT or SLC31A1 M154A plasmid. ( M ) PI staining of SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or SLC31A1 WT or SLC31A1 M154A plasmid, followed by treatment with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: Copper deprivation induced by SLC31A1 knockdown attenuates ferroptosis. ( A ) Cell viability of AsPC-1 cells treated with different doses of RSL3, ML162, ML210, or erastin in NC and SLC31A1 knockdown AsPC-1 cells. ( B ) Cell viability of AsPC-1 cells treated with different doses of CDDP, staurosporine, paclitaxel, bortezomib, JTC-801, or elesclomol-Cu in NC and SLC31A1 knockdown AsPC-1 cells. ( C-E ) Propidium iodide (PI) staining of NC and SLC31A1 knockdown AsPC-1 (C), MiaPaCa-2 (D), and CFPAC-1 (E) cells treated with RSL3 at the indicated concentrations in the presence or absence of ferroptosis inhibitors (ferrostatin-1/Fer-1, 5 μM or desferrioxamine/DFO, 20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( F ) Lipid peroxidation of NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. (G) Transmission electron microscopy of NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 (2.5 μM). Scale bar: 2 μm or 500 nm. ( H ) Confocal imaging of Cu-probe and Mito-tracker in the NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( I ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1. ( J ) Cell viability of NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1, followed by treatment with different doses of RSL3 or erastin. ( K ) PI staining of NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1, followed by treatment with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( L ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or SLC31A1 WT or SLC31A1 M154A plasmid. ( M ) PI staining of SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or SLC31A1 WT or SLC31A1 M154A plasmid, followed by treatment with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test.

    Article Snippet: SLC31A1 M154A (with Flag) , Shanghai Genechem , This paper.

    Techniques: Knockdown, Staining, Transmission Assay, Electron Microscopy, Imaging, shRNA, Transfection, Plasmid Preparation, Western Blot

    SLC7A11 is essential for copper deprivation-mediated ferroptosis resistance. ( A ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC), SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells. ( B ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells treated with or without TM (50 μM) for 24 h. ( C ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Propidium iodide (PI) staining of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( D ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). PI staining of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( E ) NC and SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Lipid peroxidation of the AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. ( F ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of TM (50 μM) for 2 h. ( G ) PI staining of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of BSO (500 μM) with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( H ) PI staining images of the indicated AsPC-1 cells treated with or without BSO (500 μM) plus TM sulfate (50 μM) with RSL3 at the indicated concentrations with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: SLC7A11 is essential for copper deprivation-mediated ferroptosis resistance. ( A ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC), SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells. ( B ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells treated with or without TM (50 μM) for 24 h. ( C ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Propidium iodide (PI) staining of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( D ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). PI staining of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( E ) NC and SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Lipid peroxidation of the AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. ( F ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of TM (50 μM) for 2 h. ( G ) PI staining of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of BSO (500 μM) with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( H ) PI staining images of the indicated AsPC-1 cells treated with or without BSO (500 μM) plus TM sulfate (50 μM) with RSL3 at the indicated concentrations with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test.

    Article Snippet: SLC31A1 M154A (with Flag) , Shanghai Genechem , This paper.

    Techniques: Knockdown, shRNA, Transfection, Western Blot, Staining

    SLC7A11 is essential for copper deprivation-mediated ferroptosis resistance. ( A ) Vector or flag-SLC7A11 overexpressed AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells. ( B ) AsPC-1 cells were transfected with a vector or a plasmid encoding Flag-SLC7A11 and then treated with TM (50 μM) for 24h. Western blot analysis of lysates from the indicated AsPC-1 cells. ( C ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11) with or without transfection with a blank vector or a vector encoding SLC7A11. PI staining of indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of Fer-1 (2.5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( D ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11) with or without transfection with a blank vector or a vector encoding SLC7A11. PI staining images of indicated AsPC-1 cells treated with RSL3 (0.25 μM) or TM (50 μM) in the presence or absence of Fer-1 (2.5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: SLC7A11 is essential for copper deprivation-mediated ferroptosis resistance. ( A ) Vector or flag-SLC7A11 overexpressed AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells. ( B ) AsPC-1 cells were transfected with a vector or a plasmid encoding Flag-SLC7A11 and then treated with TM (50 μM) for 24h. Western blot analysis of lysates from the indicated AsPC-1 cells. ( C ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11) with or without transfection with a blank vector or a vector encoding SLC7A11. PI staining of indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of Fer-1 (2.5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( D ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11) with or without transfection with a blank vector or a vector encoding SLC7A11. PI staining images of indicated AsPC-1 cells treated with RSL3 (0.25 μM) or TM (50 μM) in the presence or absence of Fer-1 (2.5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

    Article Snippet: SLC31A1 M154A (with Flag) , Shanghai Genechem , This paper.

    Techniques: Plasmid Preparation, Transfection, Western Blot, Knockdown, shRNA, Staining

    Copper deprivation upregulates SLC7A11 and activates AMPK-NRF2 axis. ( A ) Volcano plot of NRF2 target genes (shSLC31A1 VS shNC) generated using the data from C. ( B , C ) ChIP analyses of NRF2 binding in the SLC7A11 promoter in NRF2 knockdown AsPC-1 cells (B) or SLC31A1 knockdown AsPC-1 cells (C). ( D-G ) The oxygen consumption rate (OCR) in NC and SLC31A1 knockdown AsPC-1 cells by Seahorse assay (n = 8/group). Quantification of basal respiration (E) and ATP-linked respiration (F), the uncoupler FCCP (maximal) or the electron transport inhibitor antimycin A-baseline (G) in NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 8. Statistical significance was determined using a one-way ANOVA test. ( H ) COX activity level in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( I–K ) ATP level in the NC and SLC31A1 knockdown AsPC-1(I), MiaPaCa-2 (J), and CFPAC-1 (K) cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) ATP level in the AsPC-1 cells treated with TM (50 μM) or TEPA (1 mM) for 24 h. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) AMP/ATP ratio detected by HPLC in NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using an unpaired T test. ( N ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells. ( O ) Western blot analysis of lysates from AsPC-1 cells treated with TM at the indicated concentrations for 24 h. ( P ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with blank vector or vector encoding SLC31A1. ( Q ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with blank vector or of SLC31A1 WT- or SLC31A1 M154A.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: Copper deprivation upregulates SLC7A11 and activates AMPK-NRF2 axis. ( A ) Volcano plot of NRF2 target genes (shSLC31A1 VS shNC) generated using the data from C. ( B , C ) ChIP analyses of NRF2 binding in the SLC7A11 promoter in NRF2 knockdown AsPC-1 cells (B) or SLC31A1 knockdown AsPC-1 cells (C). ( D-G ) The oxygen consumption rate (OCR) in NC and SLC31A1 knockdown AsPC-1 cells by Seahorse assay (n = 8/group). Quantification of basal respiration (E) and ATP-linked respiration (F), the uncoupler FCCP (maximal) or the electron transport inhibitor antimycin A-baseline (G) in NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 8. Statistical significance was determined using a one-way ANOVA test. ( H ) COX activity level in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( I–K ) ATP level in the NC and SLC31A1 knockdown AsPC-1(I), MiaPaCa-2 (J), and CFPAC-1 (K) cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) ATP level in the AsPC-1 cells treated with TM (50 μM) or TEPA (1 mM) for 24 h. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) AMP/ATP ratio detected by HPLC in NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using an unpaired T test. ( N ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells. ( O ) Western blot analysis of lysates from AsPC-1 cells treated with TM at the indicated concentrations for 24 h. ( P ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with blank vector or vector encoding SLC31A1. ( Q ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with blank vector or of SLC31A1 WT- or SLC31A1 M154A.

    Article Snippet: SLC31A1 M154A (with Flag) , Shanghai Genechem , This paper.

    Techniques: Generated, Binding Assay, Knockdown, Activity Assay, Western Blot, shRNA, Transfection, Plasmid Preparation

    Copper deprivation upregulates SLC7A11 through AMPK-NRF2 axis. ( A ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). ( B ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNFE2L2#2). * indicates a non-specific band. ( C ) SLC7A11 mRNA level in NC and SLC31A1 knockdown AsPC-1 cells transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2#2). ( D ) Western blot analysis of lysates from AsPC-1 cells that were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2) and treated with TM (50 μM) or without TM for 24 h. ( E ) SLC7A11 mRNA level in AsPC-1 cells that were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2) and treated with TM (50 μM) or without TM for 24 h. ( F ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells treated with or without ML385 (5 μM) for 24 h. ( G ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid. ( H ) SLC7A11 mRNA level in SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: Copper deprivation upregulates SLC7A11 through AMPK-NRF2 axis. ( A ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). ( B ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNFE2L2#2). * indicates a non-specific band. ( C ) SLC7A11 mRNA level in NC and SLC31A1 knockdown AsPC-1 cells transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2#2). ( D ) Western blot analysis of lysates from AsPC-1 cells that were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2) and treated with TM (50 μM) or without TM for 24 h. ( E ) SLC7A11 mRNA level in AsPC-1 cells that were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2) and treated with TM (50 μM) or without TM for 24 h. ( F ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells treated with or without ML385 (5 μM) for 24 h. ( G ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid. ( H ) SLC7A11 mRNA level in SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.

    Article Snippet: SLC31A1 M154A (with Flag) , Shanghai Genechem , This paper.

    Techniques: Western Blot, Knockdown, shRNA, Transfection, Plasmid Preparation

    Copper deprivation inhibits ferroptosis by the activation of AMPK. ( A ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). Propidium iodide (PI) staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( B ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( C ) PI staining of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of Compound C (10 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: Copper deprivation inhibits ferroptosis by the activation of AMPK. ( A ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). Propidium iodide (PI) staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( B ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( C ) PI staining of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of Compound C (10 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

    Article Snippet: SLC31A1 M154A (with Flag) , Shanghai Genechem , This paper.

    Techniques: Activation Assay, Knockdown, shRNA, Transfection, Staining

    Copper deprivation inhibits ferroptosis by the activation of AMPK-NRF2-SLC7A11 pathway. ( A ) NC and SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA#2 (shNRF2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( B ) AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( C ) SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA#2 (shNRF2). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. ( D ) AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of TM (50 μM) for 2 h. ( E ) PI staining images of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of ML385 (5 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( F ) PI staining of SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid, followed by treatment with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: Copper deprivation inhibits ferroptosis by the activation of AMPK-NRF2-SLC7A11 pathway. ( A ) NC and SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA#2 (shNRF2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( B ) AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( C ) SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA#2 (shNRF2). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. ( D ) AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of TM (50 μM) for 2 h. ( E ) PI staining images of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of ML385 (5 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( F ) PI staining of SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid, followed by treatment with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

    Article Snippet: SLC31A1 M154A (with Flag) , Shanghai Genechem , This paper.

    Techniques: Activation Assay, Knockdown, Transfection, shRNA, Staining, Plasmid Preparation

    SLC31A1 knockdown inhibits ferroptosis in vivo . ( A-D ) Subcutaneous growth of NC and SLC31A1 knockdown AsPC-1 xenografts in nude mice (n = 8) treated with RSL3 (5 mg/kg, i.p., once every other day). ( A ) Tumor growth curves of NC and SLC31A1 knockdown AsPC-1 xenografts in nude mice treated with the indicated agents. Representative images of tumors and tumor weight were shown ( B ). Data are presented as mean ± SD, n = 8 mice per group; Statistical significance was determined using a two-way ANOVA test. ( C ) Total copper content in the tumor sections. Statistical significance was determined using a two-way ANOVA test. ( D and E ) Immunohistochemical staining and relative staining intensity of the indicated proteins in the tumor sections. CC3, cleaved caspase 3. Scale bar: 20 μm. Statistical significance was determined using a two-way ANOVA test.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: SLC31A1 knockdown inhibits ferroptosis in vivo . ( A-D ) Subcutaneous growth of NC and SLC31A1 knockdown AsPC-1 xenografts in nude mice (n = 8) treated with RSL3 (5 mg/kg, i.p., once every other day). ( A ) Tumor growth curves of NC and SLC31A1 knockdown AsPC-1 xenografts in nude mice treated with the indicated agents. Representative images of tumors and tumor weight were shown ( B ). Data are presented as mean ± SD, n = 8 mice per group; Statistical significance was determined using a two-way ANOVA test. ( C ) Total copper content in the tumor sections. Statistical significance was determined using a two-way ANOVA test. ( D and E ) Immunohistochemical staining and relative staining intensity of the indicated proteins in the tumor sections. CC3, cleaved caspase 3. Scale bar: 20 μm. Statistical significance was determined using a two-way ANOVA test.

    Article Snippet: SLC31A1 M154A (with Flag) , Shanghai Genechem , This paper.

    Techniques: Knockdown, In Vivo, Immunohistochemical staining, Staining

    Copper deprivation induced by SLC31A11 knockdown triggers the upregulation of SLC7A11. ( A ) Confocal imaging of Cu-probe and Mito-tracker in the NC and SLC31A1 knockdown AsPC-1 cells. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( B ) Total Fe level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( C ) Volcano plot of gene expression (the SLC31A1 knockdown [shRNA#2] versus the control; log2(fold change) ≥1; p < 0.05 between SLC31A1 knockdown and NC AsPC-1 cells. ( D ) GO analysis of differentially expressed genes between SLC31A1 knockdown (shRNA#2) and NC AsPC-1 cells. ( E-G ) Western blot analysis of the indicated protein levels in the NC and SLC31A1 knockdown AsPC-1 (E), MiaPaCa-2 (F), and CFPAC-1 (G) cells. ( H and I ) GPX4 (H) or FSP-1 activity (I) was tested in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( J ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( K ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) GSH level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) Cystine uptake level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: Copper deprivation induced by SLC31A11 knockdown triggers the upregulation of SLC7A11. ( A ) Confocal imaging of Cu-probe and Mito-tracker in the NC and SLC31A1 knockdown AsPC-1 cells. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( B ) Total Fe level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( C ) Volcano plot of gene expression (the SLC31A1 knockdown [shRNA#2] versus the control; log2(fold change) ≥1; p < 0.05 between SLC31A1 knockdown and NC AsPC-1 cells. ( D ) GO analysis of differentially expressed genes between SLC31A1 knockdown (shRNA#2) and NC AsPC-1 cells. ( E-G ) Western blot analysis of the indicated protein levels in the NC and SLC31A1 knockdown AsPC-1 (E), MiaPaCa-2 (F), and CFPAC-1 (G) cells. ( H and I ) GPX4 (H) or FSP-1 activity (I) was tested in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( J ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( K ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) GSH level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) Cystine uptake level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.

    Article Snippet: SLC31A1 WT (with Flag) , Shanghai Genechem , This paper.

    Techniques: Knockdown, Imaging, Gene Expression, shRNA, Control, Western Blot, Activity Assay

    Copper deprivation induced by SLC31A1 knockdown attenuates ferroptosis. ( A ) Cell viability of AsPC-1 cells treated with different doses of RSL3, ML162, ML210, or erastin in NC and SLC31A1 knockdown AsPC-1 cells. ( B ) Cell viability of AsPC-1 cells treated with different doses of CDDP, staurosporine, paclitaxel, bortezomib, JTC-801, or elesclomol-Cu in NC and SLC31A1 knockdown AsPC-1 cells. ( C-E ) Propidium iodide (PI) staining of NC and SLC31A1 knockdown AsPC-1 (C), MiaPaCa-2 (D), and CFPAC-1 (E) cells treated with RSL3 at the indicated concentrations in the presence or absence of ferroptosis inhibitors (ferrostatin-1/Fer-1, 5 μM or desferrioxamine/DFO, 20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( F ) Lipid peroxidation of NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. (G) Transmission electron microscopy of NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 (2.5 μM). Scale bar: 2 μm or 500 nm. ( H ) Confocal imaging of Cu-probe and Mito-tracker in the NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( I ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1. ( J ) Cell viability of NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1, followed by treatment with different doses of RSL3 or erastin. ( K ) PI staining of NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1, followed by treatment with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( L ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or SLC31A1 WT or SLC31A1 M154A plasmid. ( M ) PI staining of SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or SLC31A1 WT or SLC31A1 M154A plasmid, followed by treatment with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: Copper deprivation induced by SLC31A1 knockdown attenuates ferroptosis. ( A ) Cell viability of AsPC-1 cells treated with different doses of RSL3, ML162, ML210, or erastin in NC and SLC31A1 knockdown AsPC-1 cells. ( B ) Cell viability of AsPC-1 cells treated with different doses of CDDP, staurosporine, paclitaxel, bortezomib, JTC-801, or elesclomol-Cu in NC and SLC31A1 knockdown AsPC-1 cells. ( C-E ) Propidium iodide (PI) staining of NC and SLC31A1 knockdown AsPC-1 (C), MiaPaCa-2 (D), and CFPAC-1 (E) cells treated with RSL3 at the indicated concentrations in the presence or absence of ferroptosis inhibitors (ferrostatin-1/Fer-1, 5 μM or desferrioxamine/DFO, 20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( F ) Lipid peroxidation of NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. (G) Transmission electron microscopy of NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 (2.5 μM). Scale bar: 2 μm or 500 nm. ( H ) Confocal imaging of Cu-probe and Mito-tracker in the NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( I ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1. ( J ) Cell viability of NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1, followed by treatment with different doses of RSL3 or erastin. ( K ) PI staining of NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1, followed by treatment with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( L ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or SLC31A1 WT or SLC31A1 M154A plasmid. ( M ) PI staining of SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or SLC31A1 WT or SLC31A1 M154A plasmid, followed by treatment with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test.

    Article Snippet: SLC31A1 WT (with Flag) , Shanghai Genechem , This paper.

    Techniques: Knockdown, Staining, Transmission Assay, Electron Microscopy, Imaging, shRNA, Transfection, Plasmid Preparation, Western Blot

    SLC7A11 is essential for copper deprivation-mediated ferroptosis resistance. ( A ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC), SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells. ( B ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells treated with or without TM (50 μM) for 24 h. ( C ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Propidium iodide (PI) staining of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( D ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). PI staining of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( E ) NC and SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Lipid peroxidation of the AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. ( F ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of TM (50 μM) for 2 h. ( G ) PI staining of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of BSO (500 μM) with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( H ) PI staining images of the indicated AsPC-1 cells treated with or without BSO (500 μM) plus TM sulfate (50 μM) with RSL3 at the indicated concentrations with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: SLC7A11 is essential for copper deprivation-mediated ferroptosis resistance. ( A ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC), SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells. ( B ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells treated with or without TM (50 μM) for 24 h. ( C ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Propidium iodide (PI) staining of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( D ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). PI staining of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( E ) NC and SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Lipid peroxidation of the AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. ( F ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of TM (50 μM) for 2 h. ( G ) PI staining of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of BSO (500 μM) with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( H ) PI staining images of the indicated AsPC-1 cells treated with or without BSO (500 μM) plus TM sulfate (50 μM) with RSL3 at the indicated concentrations with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test.

    Article Snippet: SLC31A1 WT (with Flag) , Shanghai Genechem , This paper.

    Techniques: Knockdown, shRNA, Transfection, Western Blot, Staining

    SLC7A11 is essential for copper deprivation-mediated ferroptosis resistance. ( A ) Vector or flag-SLC7A11 overexpressed AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells. ( B ) AsPC-1 cells were transfected with a vector or a plasmid encoding Flag-SLC7A11 and then treated with TM (50 μM) for 24h. Western blot analysis of lysates from the indicated AsPC-1 cells. ( C ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11) with or without transfection with a blank vector or a vector encoding SLC7A11. PI staining of indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of Fer-1 (2.5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( D ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11) with or without transfection with a blank vector or a vector encoding SLC7A11. PI staining images of indicated AsPC-1 cells treated with RSL3 (0.25 μM) or TM (50 μM) in the presence or absence of Fer-1 (2.5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: SLC7A11 is essential for copper deprivation-mediated ferroptosis resistance. ( A ) Vector or flag-SLC7A11 overexpressed AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells. ( B ) AsPC-1 cells were transfected with a vector or a plasmid encoding Flag-SLC7A11 and then treated with TM (50 μM) for 24h. Western blot analysis of lysates from the indicated AsPC-1 cells. ( C ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11) with or without transfection with a blank vector or a vector encoding SLC7A11. PI staining of indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of Fer-1 (2.5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( D ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11) with or without transfection with a blank vector or a vector encoding SLC7A11. PI staining images of indicated AsPC-1 cells treated with RSL3 (0.25 μM) or TM (50 μM) in the presence or absence of Fer-1 (2.5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

    Article Snippet: SLC31A1 WT (with Flag) , Shanghai Genechem , This paper.

    Techniques: Plasmid Preparation, Transfection, Western Blot, Knockdown, shRNA, Staining

    Copper deprivation upregulates SLC7A11 and activates AMPK-NRF2 axis. ( A ) Volcano plot of NRF2 target genes (shSLC31A1 VS shNC) generated using the data from C. ( B , C ) ChIP analyses of NRF2 binding in the SLC7A11 promoter in NRF2 knockdown AsPC-1 cells (B) or SLC31A1 knockdown AsPC-1 cells (C). ( D-G ) The oxygen consumption rate (OCR) in NC and SLC31A1 knockdown AsPC-1 cells by Seahorse assay (n = 8/group). Quantification of basal respiration (E) and ATP-linked respiration (F), the uncoupler FCCP (maximal) or the electron transport inhibitor antimycin A-baseline (G) in NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 8. Statistical significance was determined using a one-way ANOVA test. ( H ) COX activity level in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( I–K ) ATP level in the NC and SLC31A1 knockdown AsPC-1(I), MiaPaCa-2 (J), and CFPAC-1 (K) cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) ATP level in the AsPC-1 cells treated with TM (50 μM) or TEPA (1 mM) for 24 h. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) AMP/ATP ratio detected by HPLC in NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using an unpaired T test. ( N ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells. ( O ) Western blot analysis of lysates from AsPC-1 cells treated with TM at the indicated concentrations for 24 h. ( P ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with blank vector or vector encoding SLC31A1. ( Q ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with blank vector or of SLC31A1 WT- or SLC31A1 M154A.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: Copper deprivation upregulates SLC7A11 and activates AMPK-NRF2 axis. ( A ) Volcano plot of NRF2 target genes (shSLC31A1 VS shNC) generated using the data from C. ( B , C ) ChIP analyses of NRF2 binding in the SLC7A11 promoter in NRF2 knockdown AsPC-1 cells (B) or SLC31A1 knockdown AsPC-1 cells (C). ( D-G ) The oxygen consumption rate (OCR) in NC and SLC31A1 knockdown AsPC-1 cells by Seahorse assay (n = 8/group). Quantification of basal respiration (E) and ATP-linked respiration (F), the uncoupler FCCP (maximal) or the electron transport inhibitor antimycin A-baseline (G) in NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 8. Statistical significance was determined using a one-way ANOVA test. ( H ) COX activity level in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( I–K ) ATP level in the NC and SLC31A1 knockdown AsPC-1(I), MiaPaCa-2 (J), and CFPAC-1 (K) cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) ATP level in the AsPC-1 cells treated with TM (50 μM) or TEPA (1 mM) for 24 h. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) AMP/ATP ratio detected by HPLC in NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using an unpaired T test. ( N ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells. ( O ) Western blot analysis of lysates from AsPC-1 cells treated with TM at the indicated concentrations for 24 h. ( P ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with blank vector or vector encoding SLC31A1. ( Q ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with blank vector or of SLC31A1 WT- or SLC31A1 M154A.

    Article Snippet: SLC31A1 WT (with Flag) , Shanghai Genechem , This paper.

    Techniques: Generated, Binding Assay, Knockdown, Activity Assay, Western Blot, shRNA, Transfection, Plasmid Preparation

    Copper deprivation upregulates SLC7A11 through AMPK-NRF2 axis. ( A ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). ( B ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNFE2L2#2). * indicates a non-specific band. ( C ) SLC7A11 mRNA level in NC and SLC31A1 knockdown AsPC-1 cells transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2#2). ( D ) Western blot analysis of lysates from AsPC-1 cells that were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2) and treated with TM (50 μM) or without TM for 24 h. ( E ) SLC7A11 mRNA level in AsPC-1 cells that were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2) and treated with TM (50 μM) or without TM for 24 h. ( F ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells treated with or without ML385 (5 μM) for 24 h. ( G ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid. ( H ) SLC7A11 mRNA level in SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: Copper deprivation upregulates SLC7A11 through AMPK-NRF2 axis. ( A ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). ( B ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNFE2L2#2). * indicates a non-specific band. ( C ) SLC7A11 mRNA level in NC and SLC31A1 knockdown AsPC-1 cells transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2#2). ( D ) Western blot analysis of lysates from AsPC-1 cells that were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2) and treated with TM (50 μM) or without TM for 24 h. ( E ) SLC7A11 mRNA level in AsPC-1 cells that were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2) and treated with TM (50 μM) or without TM for 24 h. ( F ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells treated with or without ML385 (5 μM) for 24 h. ( G ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid. ( H ) SLC7A11 mRNA level in SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.

    Article Snippet: SLC31A1 WT (with Flag) , Shanghai Genechem , This paper.

    Techniques: Western Blot, Knockdown, shRNA, Transfection, Plasmid Preparation

    Copper deprivation inhibits ferroptosis by the activation of AMPK. ( A ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). Propidium iodide (PI) staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( B ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( C ) PI staining of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of Compound C (10 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: Copper deprivation inhibits ferroptosis by the activation of AMPK. ( A ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). Propidium iodide (PI) staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( B ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( C ) PI staining of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of Compound C (10 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

    Article Snippet: SLC31A1 WT (with Flag) , Shanghai Genechem , This paper.

    Techniques: Activation Assay, Knockdown, shRNA, Transfection, Staining

    Copper deprivation inhibits ferroptosis by the activation of AMPK-NRF2-SLC7A11 pathway. ( A ) NC and SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA#2 (shNRF2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( B ) AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( C ) SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA#2 (shNRF2). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. ( D ) AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of TM (50 μM) for 2 h. ( E ) PI staining images of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of ML385 (5 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( F ) PI staining of SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid, followed by treatment with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: Copper deprivation inhibits ferroptosis by the activation of AMPK-NRF2-SLC7A11 pathway. ( A ) NC and SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA#2 (shNRF2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( B ) AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( C ) SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA#2 (shNRF2). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. ( D ) AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of TM (50 μM) for 2 h. ( E ) PI staining images of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of ML385 (5 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( F ) PI staining of SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid, followed by treatment with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

    Article Snippet: SLC31A1 WT (with Flag) , Shanghai Genechem , This paper.

    Techniques: Activation Assay, Knockdown, Transfection, shRNA, Staining, Plasmid Preparation

    SLC31A1 knockdown inhibits ferroptosis in vivo . ( A-D ) Subcutaneous growth of NC and SLC31A1 knockdown AsPC-1 xenografts in nude mice (n = 8) treated with RSL3 (5 mg/kg, i.p., once every other day). ( A ) Tumor growth curves of NC and SLC31A1 knockdown AsPC-1 xenografts in nude mice treated with the indicated agents. Representative images of tumors and tumor weight were shown ( B ). Data are presented as mean ± SD, n = 8 mice per group; Statistical significance was determined using a two-way ANOVA test. ( C ) Total copper content in the tumor sections. Statistical significance was determined using a two-way ANOVA test. ( D and E ) Immunohistochemical staining and relative staining intensity of the indicated proteins in the tumor sections. CC3, cleaved caspase 3. Scale bar: 20 μm. Statistical significance was determined using a two-way ANOVA test.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: SLC31A1 knockdown inhibits ferroptosis in vivo . ( A-D ) Subcutaneous growth of NC and SLC31A1 knockdown AsPC-1 xenografts in nude mice (n = 8) treated with RSL3 (5 mg/kg, i.p., once every other day). ( A ) Tumor growth curves of NC and SLC31A1 knockdown AsPC-1 xenografts in nude mice treated with the indicated agents. Representative images of tumors and tumor weight were shown ( B ). Data are presented as mean ± SD, n = 8 mice per group; Statistical significance was determined using a two-way ANOVA test. ( C ) Total copper content in the tumor sections. Statistical significance was determined using a two-way ANOVA test. ( D and E ) Immunohistochemical staining and relative staining intensity of the indicated proteins in the tumor sections. CC3, cleaved caspase 3. Scale bar: 20 μm. Statistical significance was determined using a two-way ANOVA test.

    Article Snippet: SLC31A1 WT (with Flag) , Shanghai Genechem , This paper.

    Techniques: Knockdown, In Vivo, Immunohistochemical staining, Staining

    Copper deprivation induced by SLC31A11 knockdown triggers the upregulation of SLC7A11. ( A ) Confocal imaging of Cu-probe and Mito-tracker in the NC and SLC31A1 knockdown AsPC-1 cells. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( B ) Total Fe level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( C ) Volcano plot of gene expression (the SLC31A1 knockdown [shRNA#2] versus the control; log2(fold change) ≥1; p < 0.05 between SLC31A1 knockdown and NC AsPC-1 cells. ( D ) GO analysis of differentially expressed genes between SLC31A1 knockdown (shRNA#2) and NC AsPC-1 cells. ( E-G ) Western blot analysis of the indicated protein levels in the NC and SLC31A1 knockdown AsPC-1 (E), MiaPaCa-2 (F), and CFPAC-1 (G) cells. ( H and I ) GPX4 (H) or FSP-1 activity (I) was tested in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( J ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( K ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) GSH level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) Cystine uptake level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: Copper deprivation induced by SLC31A11 knockdown triggers the upregulation of SLC7A11. ( A ) Confocal imaging of Cu-probe and Mito-tracker in the NC and SLC31A1 knockdown AsPC-1 cells. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( B ) Total Fe level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( C ) Volcano plot of gene expression (the SLC31A1 knockdown [shRNA#2] versus the control; log2(fold change) ≥1; p < 0.05 between SLC31A1 knockdown and NC AsPC-1 cells. ( D ) GO analysis of differentially expressed genes between SLC31A1 knockdown (shRNA#2) and NC AsPC-1 cells. ( E-G ) Western blot analysis of the indicated protein levels in the NC and SLC31A1 knockdown AsPC-1 (E), MiaPaCa-2 (F), and CFPAC-1 (G) cells. ( H and I ) GPX4 (H) or FSP-1 activity (I) was tested in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( J ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( K ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) GSH level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) Cystine uptake level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.

    Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

    Techniques: Knockdown, Imaging, Gene Expression, shRNA, Control, Western Blot, Activity Assay

    Copper deprivation induced by SLC31A1 knockdown attenuates ferroptosis. ( A ) Cell viability of AsPC-1 cells treated with different doses of RSL3, ML162, ML210, or erastin in NC and SLC31A1 knockdown AsPC-1 cells. ( B ) Cell viability of AsPC-1 cells treated with different doses of CDDP, staurosporine, paclitaxel, bortezomib, JTC-801, or elesclomol-Cu in NC and SLC31A1 knockdown AsPC-1 cells. ( C-E ) Propidium iodide (PI) staining of NC and SLC31A1 knockdown AsPC-1 (C), MiaPaCa-2 (D), and CFPAC-1 (E) cells treated with RSL3 at the indicated concentrations in the presence or absence of ferroptosis inhibitors (ferrostatin-1/Fer-1, 5 μM or desferrioxamine/DFO, 20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( F ) Lipid peroxidation of NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. (G) Transmission electron microscopy of NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 (2.5 μM). Scale bar: 2 μm or 500 nm. ( H ) Confocal imaging of Cu-probe and Mito-tracker in the NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( I ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1. ( J ) Cell viability of NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1, followed by treatment with different doses of RSL3 or erastin. ( K ) PI staining of NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1, followed by treatment with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( L ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or SLC31A1 WT or SLC31A1 M154A plasmid. ( M ) PI staining of SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or SLC31A1 WT or SLC31A1 M154A plasmid, followed by treatment with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: Copper deprivation induced by SLC31A1 knockdown attenuates ferroptosis. ( A ) Cell viability of AsPC-1 cells treated with different doses of RSL3, ML162, ML210, or erastin in NC and SLC31A1 knockdown AsPC-1 cells. ( B ) Cell viability of AsPC-1 cells treated with different doses of CDDP, staurosporine, paclitaxel, bortezomib, JTC-801, or elesclomol-Cu in NC and SLC31A1 knockdown AsPC-1 cells. ( C-E ) Propidium iodide (PI) staining of NC and SLC31A1 knockdown AsPC-1 (C), MiaPaCa-2 (D), and CFPAC-1 (E) cells treated with RSL3 at the indicated concentrations in the presence or absence of ferroptosis inhibitors (ferrostatin-1/Fer-1, 5 μM or desferrioxamine/DFO, 20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( F ) Lipid peroxidation of NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. (G) Transmission electron microscopy of NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 (2.5 μM). Scale bar: 2 μm or 500 nm. ( H ) Confocal imaging of Cu-probe and Mito-tracker in the NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( I ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1. ( J ) Cell viability of NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1, followed by treatment with different doses of RSL3 or erastin. ( K ) PI staining of NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1, followed by treatment with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( L ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or SLC31A1 WT or SLC31A1 M154A plasmid. ( M ) PI staining of SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or SLC31A1 WT or SLC31A1 M154A plasmid, followed by treatment with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test.

    Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

    Techniques: Knockdown, Staining, Transmission Assay, Electron Microscopy, Imaging, shRNA, Transfection, Plasmid Preparation, Western Blot

    SLC7A11 is essential for copper deprivation-mediated ferroptosis resistance. ( A ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC), SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells. ( B ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells treated with or without TM (50 μM) for 24 h. ( C ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Propidium iodide (PI) staining of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( D ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). PI staining of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( E ) NC and SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Lipid peroxidation of the AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. ( F ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of TM (50 μM) for 2 h. ( G ) PI staining of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of BSO (500 μM) with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( H ) PI staining images of the indicated AsPC-1 cells treated with or without BSO (500 μM) plus TM sulfate (50 μM) with RSL3 at the indicated concentrations with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: SLC7A11 is essential for copper deprivation-mediated ferroptosis resistance. ( A ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC), SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells. ( B ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells treated with or without TM (50 μM) for 24 h. ( C ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Propidium iodide (PI) staining of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( D ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). PI staining of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( E ) NC and SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Lipid peroxidation of the AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. ( F ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of TM (50 μM) for 2 h. ( G ) PI staining of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of BSO (500 μM) with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( H ) PI staining images of the indicated AsPC-1 cells treated with or without BSO (500 μM) plus TM sulfate (50 μM) with RSL3 at the indicated concentrations with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test.

    Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

    Techniques: Knockdown, shRNA, Transfection, Western Blot, Staining

    SLC7A11 is essential for copper deprivation-mediated ferroptosis resistance. ( A ) Vector or flag-SLC7A11 overexpressed AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells. ( B ) AsPC-1 cells were transfected with a vector or a plasmid encoding Flag-SLC7A11 and then treated with TM (50 μM) for 24h. Western blot analysis of lysates from the indicated AsPC-1 cells. ( C ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11) with or without transfection with a blank vector or a vector encoding SLC7A11. PI staining of indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of Fer-1 (2.5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( D ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11) with or without transfection with a blank vector or a vector encoding SLC7A11. PI staining images of indicated AsPC-1 cells treated with RSL3 (0.25 μM) or TM (50 μM) in the presence or absence of Fer-1 (2.5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: SLC7A11 is essential for copper deprivation-mediated ferroptosis resistance. ( A ) Vector or flag-SLC7A11 overexpressed AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells. ( B ) AsPC-1 cells were transfected with a vector or a plasmid encoding Flag-SLC7A11 and then treated with TM (50 μM) for 24h. Western blot analysis of lysates from the indicated AsPC-1 cells. ( C ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11) with or without transfection with a blank vector or a vector encoding SLC7A11. PI staining of indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of Fer-1 (2.5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( D ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11) with or without transfection with a blank vector or a vector encoding SLC7A11. PI staining images of indicated AsPC-1 cells treated with RSL3 (0.25 μM) or TM (50 μM) in the presence or absence of Fer-1 (2.5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

    Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

    Techniques: Plasmid Preparation, Transfection, Western Blot, Knockdown, shRNA, Staining

    Copper deprivation upregulates SLC7A11 and activates AMPK-NRF2 axis. ( A ) Volcano plot of NRF2 target genes (shSLC31A1 VS shNC) generated using the data from C. ( B , C ) ChIP analyses of NRF2 binding in the SLC7A11 promoter in NRF2 knockdown AsPC-1 cells (B) or SLC31A1 knockdown AsPC-1 cells (C). ( D-G ) The oxygen consumption rate (OCR) in NC and SLC31A1 knockdown AsPC-1 cells by Seahorse assay (n = 8/group). Quantification of basal respiration (E) and ATP-linked respiration (F), the uncoupler FCCP (maximal) or the electron transport inhibitor antimycin A-baseline (G) in NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 8. Statistical significance was determined using a one-way ANOVA test. ( H ) COX activity level in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( I–K ) ATP level in the NC and SLC31A1 knockdown AsPC-1(I), MiaPaCa-2 (J), and CFPAC-1 (K) cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) ATP level in the AsPC-1 cells treated with TM (50 μM) or TEPA (1 mM) for 24 h. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) AMP/ATP ratio detected by HPLC in NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using an unpaired T test. ( N ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells. ( O ) Western blot analysis of lysates from AsPC-1 cells treated with TM at the indicated concentrations for 24 h. ( P ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with blank vector or vector encoding SLC31A1. ( Q ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with blank vector or of SLC31A1 WT- or SLC31A1 M154A.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: Copper deprivation upregulates SLC7A11 and activates AMPK-NRF2 axis. ( A ) Volcano plot of NRF2 target genes (shSLC31A1 VS shNC) generated using the data from C. ( B , C ) ChIP analyses of NRF2 binding in the SLC7A11 promoter in NRF2 knockdown AsPC-1 cells (B) or SLC31A1 knockdown AsPC-1 cells (C). ( D-G ) The oxygen consumption rate (OCR) in NC and SLC31A1 knockdown AsPC-1 cells by Seahorse assay (n = 8/group). Quantification of basal respiration (E) and ATP-linked respiration (F), the uncoupler FCCP (maximal) or the electron transport inhibitor antimycin A-baseline (G) in NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 8. Statistical significance was determined using a one-way ANOVA test. ( H ) COX activity level in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( I–K ) ATP level in the NC and SLC31A1 knockdown AsPC-1(I), MiaPaCa-2 (J), and CFPAC-1 (K) cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) ATP level in the AsPC-1 cells treated with TM (50 μM) or TEPA (1 mM) for 24 h. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) AMP/ATP ratio detected by HPLC in NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using an unpaired T test. ( N ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells. ( O ) Western blot analysis of lysates from AsPC-1 cells treated with TM at the indicated concentrations for 24 h. ( P ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with blank vector or vector encoding SLC31A1. ( Q ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with blank vector or of SLC31A1 WT- or SLC31A1 M154A.

    Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

    Techniques: Generated, Binding Assay, Knockdown, Activity Assay, Western Blot, shRNA, Transfection, Plasmid Preparation

    Copper deprivation upregulates SLC7A11 through AMPK-NRF2 axis. ( A ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). ( B ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNFE2L2#2). * indicates a non-specific band. ( C ) SLC7A11 mRNA level in NC and SLC31A1 knockdown AsPC-1 cells transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2#2). ( D ) Western blot analysis of lysates from AsPC-1 cells that were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2) and treated with TM (50 μM) or without TM for 24 h. ( E ) SLC7A11 mRNA level in AsPC-1 cells that were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2) and treated with TM (50 μM) or without TM for 24 h. ( F ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells treated with or without ML385 (5 μM) for 24 h. ( G ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid. ( H ) SLC7A11 mRNA level in SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: Copper deprivation upregulates SLC7A11 through AMPK-NRF2 axis. ( A ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). ( B ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNFE2L2#2). * indicates a non-specific band. ( C ) SLC7A11 mRNA level in NC and SLC31A1 knockdown AsPC-1 cells transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2#2). ( D ) Western blot analysis of lysates from AsPC-1 cells that were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2) and treated with TM (50 μM) or without TM for 24 h. ( E ) SLC7A11 mRNA level in AsPC-1 cells that were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2) and treated with TM (50 μM) or without TM for 24 h. ( F ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells treated with or without ML385 (5 μM) for 24 h. ( G ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid. ( H ) SLC7A11 mRNA level in SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.

    Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

    Techniques: Western Blot, Knockdown, shRNA, Transfection, Plasmid Preparation

    Copper deprivation inhibits ferroptosis by the activation of AMPK. ( A ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). Propidium iodide (PI) staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( B ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( C ) PI staining of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of Compound C (10 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: Copper deprivation inhibits ferroptosis by the activation of AMPK. ( A ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). Propidium iodide (PI) staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( B ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( C ) PI staining of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of Compound C (10 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

    Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

    Techniques: Activation Assay, Knockdown, shRNA, Transfection, Staining

    Copper deprivation inhibits ferroptosis by the activation of AMPK-NRF2-SLC7A11 pathway. ( A ) NC and SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA#2 (shNRF2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( B ) AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( C ) SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA#2 (shNRF2). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. ( D ) AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of TM (50 μM) for 2 h. ( E ) PI staining images of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of ML385 (5 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( F ) PI staining of SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid, followed by treatment with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: Copper deprivation inhibits ferroptosis by the activation of AMPK-NRF2-SLC7A11 pathway. ( A ) NC and SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA#2 (shNRF2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( B ) AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( C ) SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA#2 (shNRF2). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. ( D ) AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of TM (50 μM) for 2 h. ( E ) PI staining images of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of ML385 (5 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( F ) PI staining of SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid, followed by treatment with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

    Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

    Techniques: Activation Assay, Knockdown, Transfection, shRNA, Staining, Plasmid Preparation

    SLC31A1 knockdown inhibits ferroptosis in vivo . ( A-D ) Subcutaneous growth of NC and SLC31A1 knockdown AsPC-1 xenografts in nude mice (n = 8) treated with RSL3 (5 mg/kg, i.p., once every other day). ( A ) Tumor growth curves of NC and SLC31A1 knockdown AsPC-1 xenografts in nude mice treated with the indicated agents. Representative images of tumors and tumor weight were shown ( B ). Data are presented as mean ± SD, n = 8 mice per group; Statistical significance was determined using a two-way ANOVA test. ( C ) Total copper content in the tumor sections. Statistical significance was determined using a two-way ANOVA test. ( D and E ) Immunohistochemical staining and relative staining intensity of the indicated proteins in the tumor sections. CC3, cleaved caspase 3. Scale bar: 20 μm. Statistical significance was determined using a two-way ANOVA test.

    Journal: Redox Biology

    Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

    doi: 10.1016/j.redox.2026.104130

    Figure Lengend Snippet: SLC31A1 knockdown inhibits ferroptosis in vivo . ( A-D ) Subcutaneous growth of NC and SLC31A1 knockdown AsPC-1 xenografts in nude mice (n = 8) treated with RSL3 (5 mg/kg, i.p., once every other day). ( A ) Tumor growth curves of NC and SLC31A1 knockdown AsPC-1 xenografts in nude mice treated with the indicated agents. Representative images of tumors and tumor weight were shown ( B ). Data are presented as mean ± SD, n = 8 mice per group; Statistical significance was determined using a two-way ANOVA test. ( C ) Total copper content in the tumor sections. Statistical significance was determined using a two-way ANOVA test. ( D and E ) Immunohistochemical staining and relative staining intensity of the indicated proteins in the tumor sections. CC3, cleaved caspase 3. Scale bar: 20 μm. Statistical significance was determined using a two-way ANOVA test.

    Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

    Techniques: Knockdown, In Vivo, Immunohistochemical staining, Staining

    PKA mitigated copper overload triggered by SiNPs. (A) In the SiNPs-instilled rats, enhanced copper contents in both serum (a) and myocardial tissues (b) were detected, but PKA agonist Forskolin reversed it. n = 9-10 per group. (B) The dose-dependent elevation of intracellular Cu 2+ content by SiNPs treatment in the in vitro cultured AC16 cardiomyocytes (a), which could be greatly reduced by PKA stimulator 8-Br-cAMP but increased by PKA inhibitor H89 (b). (C) The expressions of copper metabolism-related protein (FDX1, SLC31A1, and ATP7B) in AC16 cells were measured (C-a, protein bands; C-b, bands analysis). Also, the expression of ATP7B was measured in rat myocardial tissue (D). n = 3. ∗ p < 0.05 vs control, # p < 0.05 vs SiNPs or SiNPs + Forskolin.

    Journal: Materials Today Bio

    Article Title: PKA activation rescues myocardial injury elicited by silica nanoparticles through improving oxidative stress, mitochondrial health, and copper homeostasis

    doi: 10.1016/j.mtbio.2026.103021

    Figure Lengend Snippet: PKA mitigated copper overload triggered by SiNPs. (A) In the SiNPs-instilled rats, enhanced copper contents in both serum (a) and myocardial tissues (b) were detected, but PKA agonist Forskolin reversed it. n = 9-10 per group. (B) The dose-dependent elevation of intracellular Cu 2+ content by SiNPs treatment in the in vitro cultured AC16 cardiomyocytes (a), which could be greatly reduced by PKA stimulator 8-Br-cAMP but increased by PKA inhibitor H89 (b). (C) The expressions of copper metabolism-related protein (FDX1, SLC31A1, and ATP7B) in AC16 cells were measured (C-a, protein bands; C-b, bands analysis). Also, the expression of ATP7B was measured in rat myocardial tissue (D). n = 3. ∗ p < 0.05 vs control, # p < 0.05 vs SiNPs or SiNPs + Forskolin.

    Article Snippet: Primary antibodies for PKA, p -PKA, p -DRP1 s637 , SLC31A1, and ATP7B were purchased from ABclonal, China; FDX1 from Proteintech, USA; and DRP1 and GAPDH from CST, USA.

    Techniques: In Vitro, Cell Culture, Expressing, Control

    Transcriptomic analysis reveals tannic acid's anti-fibrotic mechanisms in injured rabbit corneas. ( A ) Volcano plot showing differentially expressed genes (DEGs) between TA-treated and control groups ( n = 3). ( B ) Gene Ontology (GO) enrichment analysis of DEGs, categorized into biological process (BP), cellular component (CC), and molecular function (MF). ( C ) Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis of DEGs. ( D ) Gene Set Enrichment Analysis (GSEA) based on REACTOME gene sets. ( E ) Heatmap displaying key DEGs associated with inflammatory response, redox homeostasis, and corneal scarring. ( F – K ) RT-qPCR validation of mRNA expression levels of representative genes in rabbit corneas at day 28 following different treatments ( n = 3), including F SOD2 , G ACTA2 , H IL1B , I LOX , J LOXL2 , and K SLC31A1 . * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001. Mean ± SD, 1-way ANOVA.

    Journal: Investigative Ophthalmology & Visual Science

    Article Title: Tannic Acid Achieves Rapid Scar-Free Corneal Healing by Chelating Excess Copper to Suppress Aberrant LOX-Mediated Fibrosis

    doi: 10.1167/iovs.67.3.13

    Figure Lengend Snippet: Transcriptomic analysis reveals tannic acid's anti-fibrotic mechanisms in injured rabbit corneas. ( A ) Volcano plot showing differentially expressed genes (DEGs) between TA-treated and control groups ( n = 3). ( B ) Gene Ontology (GO) enrichment analysis of DEGs, categorized into biological process (BP), cellular component (CC), and molecular function (MF). ( C ) Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis of DEGs. ( D ) Gene Set Enrichment Analysis (GSEA) based on REACTOME gene sets. ( E ) Heatmap displaying key DEGs associated with inflammatory response, redox homeostasis, and corneal scarring. ( F – K ) RT-qPCR validation of mRNA expression levels of representative genes in rabbit corneas at day 28 following different treatments ( n = 3), including F SOD2 , G ACTA2 , H IL1B , I LOX , J LOXL2 , and K SLC31A1 . * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001. Mean ± SD, 1-way ANOVA.

    Article Snippet: After blocking, membranes were incubated with primary antibodies against LOX (1:1000, 17958-1-AP; Proteintech), LOXL2 (1:1000, GTX105085; GeneTex), CTR1 (1:5000, 67221-1-Ig; Proteintech), VIM (1:20000, 60330-1-Ig; Proteintech), α-SMA (1:5000, 14395-1-AP; Proteintech), IL-1β (1:1000, ab234437; Abcam), and β-actin (1:10000, AC026; ABclonal), followed by HRP-conjugated secondary antibodies (1:10000, SA00001-2; Proteintech).

    Techniques: Control, Quantitative RT-PCR, Biomarker Discovery, Expressing

    Tannic acid reduces fibrosis by chelating excess copper to inhibit lox expression and activity. ( A ) Quantitative analysis of copper concentration in corneal tissues following different treatments (FK = fungal keratitis; CED = corneal epithelial defect; n = 3). ( B ) Quantitative analysis of LOX enzymatic activity in corneal tissues following different treatments ( n = 3). ( C ) Quantitative analysis of central corneal thickness in TA-treated ALK model at day 56 compared with healthy controls ( n = 3). ( D ) Representative Western blot images of LOX, LOXL2, CTR1, VIM, α-SMA, IL-1β, and β-actin protein expression in rabbit corneas at day 28 and ( E – J ) corresponding quantitative analyses of E LOX, F LOXL2, G CTR1, H VIM, I α-SMA, and J IL-1β protein levels ( n = 3). ns, not significant, * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001. Mean ± SD, 1-way ANOVA.

    Journal: Investigative Ophthalmology & Visual Science

    Article Title: Tannic Acid Achieves Rapid Scar-Free Corneal Healing by Chelating Excess Copper to Suppress Aberrant LOX-Mediated Fibrosis

    doi: 10.1167/iovs.67.3.13

    Figure Lengend Snippet: Tannic acid reduces fibrosis by chelating excess copper to inhibit lox expression and activity. ( A ) Quantitative analysis of copper concentration in corneal tissues following different treatments (FK = fungal keratitis; CED = corneal epithelial defect; n = 3). ( B ) Quantitative analysis of LOX enzymatic activity in corneal tissues following different treatments ( n = 3). ( C ) Quantitative analysis of central corneal thickness in TA-treated ALK model at day 56 compared with healthy controls ( n = 3). ( D ) Representative Western blot images of LOX, LOXL2, CTR1, VIM, α-SMA, IL-1β, and β-actin protein expression in rabbit corneas at day 28 and ( E – J ) corresponding quantitative analyses of E LOX, F LOXL2, G CTR1, H VIM, I α-SMA, and J IL-1β protein levels ( n = 3). ns, not significant, * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001. Mean ± SD, 1-way ANOVA.

    Article Snippet: After blocking, membranes were incubated with primary antibodies against LOX (1:1000, 17958-1-AP; Proteintech), LOXL2 (1:1000, GTX105085; GeneTex), CTR1 (1:5000, 67221-1-Ig; Proteintech), VIM (1:20000, 60330-1-Ig; Proteintech), α-SMA (1:5000, 14395-1-AP; Proteintech), IL-1β (1:1000, ab234437; Abcam), and β-actin (1:10000, AC026; ABclonal), followed by HRP-conjugated secondary antibodies (1:10000, SA00001-2; Proteintech).

    Techniques: Expressing, Activity Assay, Concentration Assay, Western Blot

    Exogenous copper supplementation reverses tannic acid's anti-fibrotic effects. ( A ) Representative Western blot images of LOX, LOXL2, CTR1, VIM, α-SMA, and β-actin protein expression in rabbit corneas at day 28 following different treatments and ( B – F ) corresponding quantitative analyses of B LOX, C LOXL2, D CTR1, E VIM, and F α-SMA protein levels ( n = 3). * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001. Mean ± SD, n = 3; 1-way ANOVA.

    Journal: Investigative Ophthalmology & Visual Science

    Article Title: Tannic Acid Achieves Rapid Scar-Free Corneal Healing by Chelating Excess Copper to Suppress Aberrant LOX-Mediated Fibrosis

    doi: 10.1167/iovs.67.3.13

    Figure Lengend Snippet: Exogenous copper supplementation reverses tannic acid's anti-fibrotic effects. ( A ) Representative Western blot images of LOX, LOXL2, CTR1, VIM, α-SMA, and β-actin protein expression in rabbit corneas at day 28 following different treatments and ( B – F ) corresponding quantitative analyses of B LOX, C LOXL2, D CTR1, E VIM, and F α-SMA protein levels ( n = 3). * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001. Mean ± SD, n = 3; 1-way ANOVA.

    Article Snippet: After blocking, membranes were incubated with primary antibodies against LOX (1:1000, 17958-1-AP; Proteintech), LOXL2 (1:1000, GTX105085; GeneTex), CTR1 (1:5000, 67221-1-Ig; Proteintech), VIM (1:20000, 60330-1-Ig; Proteintech), α-SMA (1:5000, 14395-1-AP; Proteintech), IL-1β (1:1000, ab234437; Abcam), and β-actin (1:10000, AC026; ABclonal), followed by HRP-conjugated secondary antibodies (1:10000, SA00001-2; Proteintech).

    Techniques: Western Blot, Expressing